For qPCR, total RNA was extracted using RNAeasy Plus (Qiagen) according to manufacturer’s protocol. qPCR primers for human Complex IV subunit 4I1 (Forward: CATGTGGCAGAAGCACTATGTGT; Reverse: GCCACCCACTCTTTGTCAAAG), human COX17 (Forward: CGATGCGTGTATCATCGAGAA; Reverse: TCATGCATTCCTTGTGGGC), mouse COX20 (Forward: CTTACAAGGTTCCACTGTAGGTAT; Reverse: TGAAGTTGCTTAGCTGCTGTTG), mouse SOX2 (Forward: AAGAAAGGAGAGAAGTTTGGAGCC; Reverse: GAGATCTGGCGGAGAATAGTTGG), mouse OCT4 (Forward: AGAACATGTGTAAGCTGCGG; Reverse: AGAACATGTGTAAGCTGCGG), mouse NANOG (Forward: AGGGTCTGCTACTGAGATGCTCTG; Reverse: CAACCACTGGTTTTTCTGCCACCG), human SOX2 (Forward: TAAATACCGGCCCCGGCGGA; Reverse: TGCCGTTGCTCCAGCCGTTC), human OCT4 (Forward: TGCCGTTGCTCCAGCCGTTC; Reverse: AAATAGAACCCCCAGGGTGAGC), human NANOG (Forward: ACATGCAACCTGAAGACGTGT; Reverse: CATGGAAACCAGAACACGTGG), human GAPDH (Forward: CTTCAACAGCGACACCCACTCCTC; Reverse: GTCCACCCTGTTGCTGTAG), mouse actin (Forward: TGAGCTGCGTTTTACACCCT; Reverse: TTTGGGGGATGTTTGCTCCA) and mouse GAPDH (Forward: TCACCACCATGGAGAAGGC; Reverse: GCTAAGCAGTTGGTGGTGCA) were obtained from IDT. Cytochrome c oxidase activity For transwell assays, cells (25,000 cells for bulk LM2 or FACS sorted SOX2/OCT4− GFP− and SOX2/OCT4+GFP+; 40,000 for MDA-MB-468; 60,000 cells for ML1) were plated in triplicates onto the top chamber of 6.5 mm inserts, coated with Matrigel (Corning #356231), in 24-well plates with serum-free DMEM. The cells were treated with TM or vehicle for 48 h before plating the cells for invasion. The bottom chamber contained complete DMEM media with 10% FBS. The cells migrated for 24 h. After migration, the insert was washed twice with fresh PBS and fixed using Kwik-Diff™ Staining kit (ThermoFisher), according to the manufacturer’s protocol. After staining, images were obtained using a computerized Zeiss microscope (Axiovert 200 M) and analyzed using Axiovision 4.6 software (Carl Zeiss Inc.). For assays using AICAR (1.25 mM) and A-769662 (12.5 µM), cells were either pre-treated with a drug or control for 24 h before plating for invasion. For rescue experiments with copper, cells were treated with 0.5 µM CuCl 2 for at least 2 h before plating the cells in the top chamber and continued with CuCl 2 treatment for the remainder of the experiment. For rescue experiments with siAMPK (SCBT) or siControl (SCBT), cells were either treated with TM (0.5 µM) or not (controls) for 24 h prior to transfecting siAMPK (10 nM) or siControl (10 nM) using Lipofectamine3000. Cells (25,000) were plated on Matrigel-coated inserts for invasion assay, 48 h after transfection with siAMPK or siControl in the presence or absence of TM. Inserts were stained after 24 h of plating. LC–MS proteomic analysis Brewer, G. J. et al. Treatment of metastatic cancer with tetrathiomolybdate, an anticopper, antiangiogenic agent: Phase I study. Clin. Cancer Res. 6, 1–10 (2000).

Write down expressions for all the individual values (the first two are done for you above), and then multiply those expressions together. You will find that all the terms for the intermediate ions cancel out to leave you with the expression for the overall stability constant. Lowndes, S. & Harris, A. Copper chelation as an antiangiogenic therapy. Oncol. Res. 14, 529–539 (2004).Fouani, L., Menezes, S. V., Paulson, M., Richardson, D. R. & Kovacevic, Z. Metals and metastasis: exploiting the role of metals in cancer metastasis to develop novel anti-metastatic agents. Pharm. Res. 115, 275–287 (2017).

Johnstone, C. N. et al. Functional and molecular characterisation of EO771.LMB tumours, a new C57BL/6-mouse-derived model of spontaneously metastatic mammary cancer. Dis. Models Mech. 8, 237–251 (2015). Kim, K. K. et al. Tetrathiomolybdate inhibits mitochondrial complex IV and mediates degradation of hypoxia-inducible factor-1alpha in cancer cells. Sci. Rep. 5, 14296 (2015). If you compare the two equilibria below, the one with the 1,2-diaminoethane ("en") has the higher equilibrium (stability) constant (for values, see above). TA, et al. (2015). Copper, zinc and iron levels in infants and their mothers during the first year of life: A prospective study. While our study uncovers that copper depletion by altering metabolic reprogramming of select population of SOX2/OCT4+ metastatic cells that reside in the primary tumor, as a potential antimetastatic therapeutic strategy, it has been reported that in the context of metastasis, copper also serves as a critical co-factor for lysyl oxidase that has been implicated in the establishment of the premetastatic niche 61. Hypoxic primary breast tumors secrete lysyl oxidase-like 2 (LOXL2), a copper-dependent amine oxidase 64 that crosslinks collagen with elastin to generate a stiffened extracellular matrix (ECM), to generate “pre-metastatic niches” that support metastatic colonization and outgrowth 61, 65, 66. Indeed, we previously reported that copper depletion impacts TNBC metastasis through inactivation of lysyl oxidase in preclinical models, and notably, in the phase 2 TM trial, serum LOXL2 was reduced over time in patients who were copper depleted 23, 64.Richmond S, et al. (2013). Copper bracelets and magnetic wrist straps for rheumatoid arthritis – analgesic and anti-inflammatory effects: A randomised double-blind placebo controlled crossover trial. Copper is an essential cofactor for a host of metalloenzymes/proteins including superoxide dismutase-1 (SOD1), vascular adhesion protein-1, MMP-9, lysyl oxidase, VEGF, and angiogenin 10, 11, 12 that contribute to carcinogenesis 11, 13, 14, 15. Copper was shown to be a necessary binding partner for MEK1/2-mediated BRAF signaling in melanoma progression 16, copper depletion was able to overcome resistance to BRAF and MEK1/2 inhibitors 17, and regulate autophagy in lung adenocarcinoma 18. In a model of colon cancer, inflammatory cytokines, such as IL-17 was shown to induce increased intracellular uptake of copper via increased expression of metalloreductase STEAP4, to promote tumorigenesis 19. A recent study also demonstrated that copper chelators mediate ubiquitin-dependent PD-L1 degradation via inhibition of STAT3 and EGFR phosphorylation 20. Copper chaperone, ATOX1, has been demonstrated as an important mediator of breast cancer metastasis, and therefore a potential biomarker for the effectiveness of copper depletion therapy 21. In the Her2/neu breast cancer transgenic mice, TM treatment was associated with improved disease-free survival 22. Our phase II clinical trial of TM (NCT00195091) 23, with 75 breast cancer patients at high risk for relapse showed that TM was safe and well-tolerated with <3% reversible grade 3 or 4 adverse events. Importantly, this trial reported an event-free survival (EFS) of 72% and overall survival (OS) of 84% at a median follow-up of 6.3 years 23. In this trial, the TNBC cohort with stage 4 disease showed EFS of 69% after 2 years; a striking finding as median EFS and OS of stage 4 TNBC patients is less than 8 months and 12 months, respectively, from multiple trials 24, 25. Advancing TM into larger randomized phase II trials will be facilitated by a better understanding of the mechanisms by which copper depletion impacts metastasis and may also inform patient selection for future trials. Samples were reconstituted in 1 mL of 2% ACN/25 mM ABC. Peptides were fractionated into 48 fractions. An Ultimate 3000 HPLC (Dionex) coupled to an Ultimate 3000 Fraction Collector using a Waters XBridge BEH130 C18 column (3.5 um 4.6 × 250 mm) was operated at 1 mL/min. Buffer A consisted of 100% water, buffer B consisted of 100% acetonitrile, and buffer C consisted of 25 mM ABC. The fractionation gradient operated as follows: 1% B to 5% B in 1 min, 5% B to 35% B in 61 min, 35% B to 60% B in 5 min, 60% B to 70% B in 3 min, 70% B to 1% B in 10 min, with 10% C the entire gradient to maintain pH. The 48 fractions were then concatenated to 12 fractions (i.e., fractions 1, 13, 25, 37 were pooled, followed by fractions 2, 14, 26, 38, etc.) so that every 12th fraction was used to pool. Pooled fractions were vacuum-centrifuged then reconstituted in 1% ACN/0.1% FA for LC–MS/MS. A too high intake of copper will noticeably impact one’s zinc and Vitamin C levels in a negative way. Similarly, too high intakes of zinc and Vitamin C will do the exact same to one’s copper levels. The three have a tumultuous relationship within the human body, and this is why figuring out the exact amount required for harmony amongst all three elements is so important.

Brady, D. C. et al. Copper is required for oncogenic BRAF signalling and tumorigenesis. Nature 509, 492–496 (2014). This is an effect which happens when you replace water (or other simple ligands) around the central metal ion by multidentate ligands like 1,2-diaminoethane (often abbreviated to "en") or EDTA. Kim, K. I. et al. Detection of increased 64Cu uptake by human copper transporter 1 gene overexpression using PET with 64CuCl2 in human breast cancer xenograft model. J. Nucl. Med. 55, 1692–1698 (2014).Copper ions are essential for biological function yet are severely detrimental when present in excess. At the molecular level, copper ions catalyze the production of hydroxyl radicals that can irreversibly alter essential bio-molecules. Hence, selective copper chelators that can remove excess copper ions and alleviate oxidative stress will help assuage copper-overload diseases. However, most currently available chelators are non-specific leading to multiple undesirable side-effects. The challenge is to build chelators that can bind to copper ions with high affinity but leave the levels of essential metal ions unaltered. Here we report the design and development of redox-state selective Cu ion chelators that have 10 8 times higher conditional stability constants toward Cu 2+ compared to both Cu + and other biologically relevant metal ions. This unique selectivity allows the specific removal of Cu 2+ ions that would be available only under pathophysiological metal overload and oxidative stress conditions and provides access to effective removal of the aberrant redox-cycling Cu ion pool without affecting the essential non-redox cycling Cu + labile pool. We have shown that the chelators provide distinct protection against copper-induced oxidative stress in vitro and in live cells via selective Cu 2+ ion chelation. Notably, the chelators afford significant reduction in Cu-induced oxidative damage in Atp7a −/− Menkes disease model cells that have endogenously high levels of Cu ions. Finally, in vivo testing of our chelators in a live zebrafish larval model demonstrate their protective properties against copper-induced oxidative stress.